[beth67]

I found out in July I have celiac disease. I've been reading a really good book by Dr. Peter Green who is the director of the celiac disease center at Columbia University. He said that the children of celiacs should be tested. I told my twelve year old this and he freaked out. He has a tendency to pass out during blood tests so this is going to be a dramatic thing for me and him. I'm thinking of doing the genetic test first and if that is positive get the blood test. Has anyone done the genetic test? I see on this site there is an ad for my celiac id genetic test. I'm wondering if one company is better than another. Any advice would be appreciated. Thanks.

Beth

[StephanieM]

I had been gluten free for a year before getting tested, and my antibody came back negative, so I decided to do the genetic test, as I KNEW I had celiac based on how much a gluten-free diet improved my entire body, head to toe.

I used "KIMBALL GENETICS" based in Colorado. I live in Canada.. I ordered the saliva kit online and it arrived within a few days. I swabbed both cheeks and sent it off. My results were back in less than 2 weeks. I tested positive for 2 alleles on the same Celiac gene. they tell you exactly which gene you carry and how many alleles that way you will know if he's just a carrier or if he has the potential to have full blown Celiac when his gene decides to express itself..

I was amazed at how quick the results came back...

Stephanie

[happygirl]

The new issue of Living Without magazine has an article that discusses gene testing companies that specialize in Celiac, and they list Kimball Genetics and Prometheus Labs as having non-blood options. Kimball-cheek swab, Prometheus-saliva.

www.kimballgenetics.com or myceliacid.com

Living Without discusses how these two (along with Mayo) "specialize in genetic testing for celiac disease, performing the more in-depth heterodimer DQ2 analysis"

[tarnalberry]

The problem is, not having the currently identified and tested for genes doesn't ACTUALLY rule out a problem with gluten. Not only will it miss some (albeit a small percentage) of actual celiac disease cases, but it will also miss a larger (but undetermined) number of gluten sensitivity cases.

Honestly, when the best a test can tell you is "maybe, probably, but we don't really know" I kinda don't fine the test worthwhile. That's just my opinion, however, and other people have found it more useful.

[BlueTaelon]

tarnalberry, on Oct 28 2009, 06:02 PM, said:

The problem is, not having the currently identified and tested for genes doesn't ACTUALLY rule out a problem with gluten. Not only will it miss some (albeit a small percentage) of actual celiac disease cases, but it will also miss a larger (but undetermined) number of gluten sensitivity cases.

Honestly, when the best a test can tell you is "maybe, probably, but we don't really know" I kinda don't fine the test worthwhile. That's just my opinion, however, and other people have found it more useful.

I agree and they haven't ID'd all the celiac genes yet I don't think. I was gluten-free for a couple of years for my dd who reacted strongly to my eating gluten when she was nursing and I got really sick when I tried eating gluten again around a year of gluten-free. Neither of us could stay on gluten long enough to get a + test the symptoms were so bad. We finally did genetic testing through Kimball Genetics about 4 years into being gluten-free and both came back + for the gene. My 3 yr old was tested at only a few weeks old when I got glutened a couple of times on accident and she reacted just like my older dd did and she came back - for the gene despite reacting just as badly as we do.

[gfp]

tarnalberry, on Oct 29 2009, 03:02 AM, said:

The problem is, not having the currently identified and tested for genes doesn't ACTUALLY rule out a problem with gluten. Not only will it miss some (albeit a small percentage) of actual celiac disease cases, but it will also miss a larger (but undetermined) number of gluten sensitivity cases.

Honestly, when the best a test can tell you is "maybe, probably, but we don't really know" I kinda don't fine the test worthwhile. That's just my opinion, however, and other people have found it more useful.

Currently my partner and I had little Ollie on 29 August.
My partner who does not have celiac disease (so far as we know) has been gluten-free during breast feeding.
This seems to be working as he has jumped from 40th percentile at birth (a week early) to 97th percentile in height and mass. He has also yet to be ill, despite being surrounded by people with colds (incl. mom) he has managed not to have any illness at all in his short existence. His immune system and the IgA from mom's milk seems to be doing the job very well in other words.

Mom going gluten-free is just a precaution, plenty of studies show gliadins transferred in breast milk yet noone is sure if this might trigger later development of celiac disease or not.

With this in mind we decided on genetic testing and if he lacks any currently known genes them mom might not stick to gluten-free outside the home.

I'm wondering if we need to send samples to the US or Canada or if we can find somewhere in the UK?
How much does it cost in the US?

[nikki-uk]

gfp, on Nov 8 2009, 09:08 AM, said:

Currently my partner and I had little Ollie on 29 August.
My partner who does not have celiac disease (so far as we know) has been gluten-free during breast feeding.
This seems to be working as he has jumped from 40th percentile at birth (a week early) to 97th percentile in height and mass. He has also yet to be ill, despite being surrounded by people with colds (incl. mom) he has managed not to have any illness at all in his short existence. His immune system and the IgA from mom's milk seems to be doing the job very well in other words.

Mom going gluten-free is just a precaution, plenty of studies show gliadins transferred in breast milk yet noone is sure if this might trigger later development of celiac disease or not.

With this in mind we decided on genetic testing and if he lacks any currently known genes them mom might not stick to gluten-free outside the home.

I'm wondering if we need to send samples to the US or Canada or if we can find somewhere in the UK?
How much does it cost in the US?

CONGRATS to you both!!!!!!!!!!!

I believe this company in London tests for Coeliac disease/HLA markers (scroll down to Coeliac)
http://www.tdlpathology.com/index.php?opti...&Itemid=207

Not sure of the cost.

[gfp]

nikki-uk, on Nov 8 2009, 11:54 AM, said:

CONGRATS to you both!!!!!!!!!!!

I believe this company in London tests for Coeliac disease/HLA markers (scroll down to Coeliac)
http://www.tdlpathology.com/index.php?opti...&Itemid=207

Not sure of the cost.

Many thanks Nikki, looks just the ticket.

Would still be wondering about US costs so I can compare when I get a cost from this place...


thanks

[StephanieM]

I don't know about the UK.. I used "KIMBALL GENETICS" based in Colorado, US, and I live in Canada.. I did a cheek swab sample and tested positive for 2 alleles.. Genetic testing will let you know if he's a carrier only, or if he has 2 copies of the gene.. It's fast and comprehensive.. It cost me around $400 for it, but i feel it was worth it as they were very quick...

Stephanie

[Brooklyn528]

Quest does a Comprehensive Celiac Panel which tests for the antibodies and does the gene mapping. This is the one that i had done on my children. They both came back with the gene and positive IgG. We are going to see a Peds GI at the end of the month. I would suggest doing this test. Also, I work for a GI doctor and this is the first test he does on suspected Celiacs and their first degree relatives.

[gfp]

Brooklyn528, on Nov 8 2009, 04:55 PM, said:

Quest does a Comprehensive Celiac Panel which tests for the antibodies and does the gene mapping. This is the one that i had done on my children. They both came back with the gene and positive IgG. We are going to see a Peds GI at the end of the month. I would suggest doing this test. Also, I work for a GI doctor and this is the first test he does on suspected Celiacs and their first degree relatives.

There is really no point doing IgG when the baby is still breastfeeding and the mother is not eating gluten.
For that matter, if an adult is not eating gluten then there is no point looking for specific antibodies be they IgA or IgG.

[gfp]

The plot thickens,
I contacted the lab Nikki linked to and asked if with it being a sample of buccal mucosa if the presence of breast milk would confuse the results.

I was expecting some answer about waiting but instead I got the answer that they can't guarantee the process in these circumstances.

My thinking (which may or may not be correct) is the genetic material in breast milk from the mother includes the IgA antigens which all reside in the HLA portion of chromosome 6.

Well, I was expecting a different response (something negative or positive) rather than ...

Quote

Dear Stephen,

I’ve just spoken to the people in the laboratory regarding this potential swab sample. They’ve not actually tried this testing from a mouth swab before and cannot guarantee it would work. It would be much better to send EDTA blood from this baby if possible. We would only need 1ml.

Sorry for any confusion.

Um, OK ... what haven't you done before?

More to the point given the link between breast feeding and non development of auto immune responses ... and the fact gliadin can be detected in breast milk ... (without even getting into the complexities of mothers actually giving 'faulty' IgA in breast milk that lacks the correct suppressor T-cells) if they are celiac and eating gluten (one might presume without knowing it, then plenty of pregnant mothers to be seem to smoke so who knows)...

So all considered ... they haven't done this for a breast fed baby yet?
Then you gotta ask who have they actually done it on?

Perhaps I'm just looking too deep into this or is it possible they never actually considered the buccal mucosa is in contact with moms milk every few hours as a minimum and then every time he brings some back up?

[Jestgar]

Testing for genetic markers is done by pcr, polymerase chain reaction, which takes very small amounts of DNA and copies it over and over.

Normally they are testing between two versions of one part of a gene, so the test sections might look like this:

atgatggcctgatgatcgtaga
atgatggccagatgatcgtaga

with only the one letter being different.

If you think of an X Y plot for the next part that will help you visualize.

If both of your genes have the 't' then your test will show a dot in the lower right (maybe 4,1 on a plot)
if both of your genes have the 'a' then your test will show a dot in the upper left (maybe 1, 4 on a plot)
(or the other way around, depending on what dyes they used)

if you have one of each, your test will have a dot in the middle of the graph (maybe 2,2).

This is a representation of the kind of results you get.



Each dot is one person, and they usually run 384, or 1536 tests at one time. This is actually a very clean result, where none of the clouds overlap, but to get a picture like this is extraordinarily rare. Normally the clouds are much more spread out, and many of your dots can't be determined

This test is incredibly sensitive, and if even one cell from the mom is in the sample, the results may not be accurate. The dot will shift slightly in one direction or another, and you won't be able to tell which cloud it falls in.

I would suspect that mom sheds quite a few cells into breast milk, and from the skin on her breast, so the potential for a contaminated sample is very very high.

[gfp]

Jestgar, on Nov 9 2009, 11:41 PM, said:

This test is incredibly sensitive, and if even one cell from the mom is in the sample, the results may not be accurate. The dot will shift slightly in one direction or another, and you won't be able to tell which cloud it falls in.

I would suspect that mom sheds quite a few cells into breast milk, and from the skin on her breast, so the potential for a contaminated sample is very very high.

Thanks ... that sums it up perfectly!

Other than babies one wonders who else the genetic test is useful for. (A few obvious ones here like I'm actually growing the fetus in a test tube to harvest the kidneys and just want HLA results to check organ compatibility)

Honestly: I really doubt it's the first baby they did the test for... and the email is CYA because of the chance of screwing up the test. This is of course lucky for me asking the question ... unlucky for all those who figured their MD, Ped or the labs would point out the damned obvious!

Are not Leukocytes a component of breast milk anyway? Will these not be replicated in the PCR unless it is specific single cell PCR not to mention shedding cells from the nipple?

[Jestgar]

Mom's cells all have the same DNA. Different cells translate different parts of it into RNA, and then protein. Since the PCR test is on DNA, it doesn't matter what the source cell is.