Jump to content
  • You are not alone. Join Celiac.com for trusted gluten-free answers and forum support.



  • Celiac.com Sponsor (A1):
    Celiac.com Sponsor (A1-M):

Genetic Testing For Kids


beth67

Recommended Posts

beth67 Rookie

I found out in July I have celiac disease. I've been reading a really good book by Dr. Peter Green who is the director of the celiac disease center at Columbia University. He said that the children of celiacs should be tested. I told my twelve year old this and he freaked out. He has a tendency to pass out during blood tests so this is going to be a dramatic thing for me and him. I'm thinking of doing the genetic test first and if that is positive get the blood test. Has anyone done the genetic test? I see on this site there is an ad for my celiac id genetic test. I'm wondering if one company is better than another. Any advice would be appreciated. Thanks.

Beth


Celiac.com Sponsor (A8):
Celiac.com Sponsor (A8):



Celiac.com Sponsor (A8-M):



StephanieM Newbie

I had been gluten free for a year before getting tested, and my antibody came back negative, so I decided to do the genetic test, as I KNEW I had celiac based on how much a gluten-free diet improved my entire body, head to toe.

I used "KIMBALL GENETICS" based in Colorado. I live in Canada.. I ordered the saliva kit online and it arrived within a few days. I swabbed both cheeks and sent it off. My results were back in less than 2 weeks. I tested positive for 2 alleles on the same Celiac gene. they tell you exactly which gene you carry and how many alleles that way you will know if he's just a carrier or if he has the potential to have full blown Celiac when his gene decides to express itself..

I was amazed at how quick the results came back...

Stephanie

happygirl Collaborator

The new issue of Living Without magazine has an article that discusses gene testing companies that specialize in Celiac, and they list Kimball Genetics and Prometheus Labs as having non-blood options. Kimball-cheek swab, Prometheus-saliva.

www.kimballgenetics.com or myceliacid.com

Living Without discusses how these two (along with Mayo) "specialize in genetic testing for celiac disease, performing the more in-depth heterodimer DQ2 analysis"

tarnalberry Community Regular

The problem is, not having the currently identified and tested for genes doesn't ACTUALLY rule out a problem with gluten. Not only will it miss some (albeit a small percentage) of actual celiac disease cases, but it will also miss a larger (but undetermined) number of gluten sensitivity cases.

Honestly, when the best a test can tell you is "maybe, probably, but we don't really know" I kinda don't fine the test worthwhile. That's just my opinion, however, and other people have found it more useful.

BlueTaelon Rookie
The problem is, not having the currently identified and tested for genes doesn't ACTUALLY rule out a problem with gluten. Not only will it miss some (albeit a small percentage) of actual celiac disease cases, but it will also miss a larger (but undetermined) number of gluten sensitivity cases.

Honestly, when the best a test can tell you is "maybe, probably, but we don't really know" I kinda don't fine the test worthwhile. That's just my opinion, however, and other people have found it more useful.

I agree and they haven't ID'd all the celiac genes yet I don't think. I was gluten-free for a couple of years for my dd who reacted strongly to my eating gluten when she was nursing and I got really sick when I tried eating gluten again around a year of gluten-free. Neither of us could stay on gluten long enough to get a + test the symptoms were so bad. We finally did genetic testing through Kimball Genetics about 4 years into being gluten-free and both came back + for the gene. My 3 yr old was tested at only a few weeks old when I got glutened a couple of times on accident and she reacted just like my older dd did and she came back - for the gene despite reacting just as badly as we do.

gfp Enthusiast
The problem is, not having the currently identified and tested for genes doesn't ACTUALLY rule out a problem with gluten. Not only will it miss some (albeit a small percentage) of actual celiac disease cases, but it will also miss a larger (but undetermined) number of gluten sensitivity cases.

Honestly, when the best a test can tell you is "maybe, probably, but we don't really know" I kinda don't fine the test worthwhile. That's just my opinion, however, and other people have found it more useful.

Currently my partner and I had little Ollie on 29 August.

My partner who does not have celiac disease (so far as we know) has been gluten-free during breast feeding.

This seems to be working as he has jumped from 40th percentile at birth (a week early) to 97th percentile in height and mass. He has also yet to be ill, despite being surrounded by people with colds (incl. mom) he has managed not to have any illness at all in his short existence. His immune system and the IgA from mom's milk seems to be doing the job very well in other words.

Mom going gluten-free is just a precaution, plenty of studies show gliadins transferred in breast milk yet noone is sure if this might trigger later development of celiac disease or not.

With this in mind we decided on genetic testing and if he lacks any currently known genes them mom might not stick to gluten-free outside the home.

I'm wondering if we need to send samples to the US or Canada or if we can find somewhere in the UK?

How much does it cost in the US?

nikki-uk Enthusiast
Currently my partner and I had little Ollie on 29 August.

My partner who does not have celiac disease (so far as we know) has been gluten-free during breast feeding.

This seems to be working as he has jumped from 40th percentile at birth (a week early) to 97th percentile in height and mass. He has also yet to be ill, despite being surrounded by people with colds (incl. mom) he has managed not to have any illness at all in his short existence. His immune system and the IgA from mom's milk seems to be doing the job very well in other words.

Mom going gluten-free is just a precaution, plenty of studies show gliadins transferred in breast milk yet noone is sure if this might trigger later development of celiac disease or not.

With this in mind we decided on genetic testing and if he lacks any currently known genes them mom might not stick to gluten-free outside the home.

I'm wondering if we need to send samples to the US or Canada or if we can find somewhere in the UK?

How much does it cost in the US?

CONGRATS to you both!!!!!!!!!!! :D

I believe this company in London tests for Coeliac disease/HLA markers (scroll down to Coeliac)

Open Original Shared Link

Not sure of the cost.


Celiac.com Sponsor (A8):
Celiac.com Sponsor (A8):



Celiac.com Sponsor (A8-M):



gfp Enthusiast
CONGRATS to you both!!!!!!!!!!! :D

I believe this company in London tests for Coeliac disease/HLA markers (scroll down to Coeliac)

Open Original Shared Link

Not sure of the cost.

Many thanks Nikki, looks just the ticket.

Would still be wondering about US costs so I can compare when I get a cost from this place...

thanks

StephanieM Newbie

I don't know about the UK.. I used "KIMBALL GENETICS" based in Colorado, US, and I live in Canada.. I did a cheek swab sample and tested positive for 2 alleles.. Genetic testing will let you know if he's a carrier only, or if he has 2 copies of the gene.. It's fast and comprehensive.. It cost me around $400 for it, but i feel it was worth it as they were very quick...

Stephanie

Brooklyn528 Apprentice

Quest does a Comprehensive Celiac Panel which tests for the antibodies and does the gene mapping. This is the one that i had done on my children. They both came back with the gene and positive IgG. We are going to see a Peds GI at the end of the month. I would suggest doing this test. Also, I work for a GI doctor and this is the first test he does on suspected Celiacs and their first degree relatives.

gfp Enthusiast
Quest does a Comprehensive Celiac Panel which tests for the antibodies and does the gene mapping. This is the one that i had done on my children. They both came back with the gene and positive IgG. We are going to see a Peds GI at the end of the month. I would suggest doing this test. Also, I work for a GI doctor and this is the first test he does on suspected Celiacs and their first degree relatives.

There is really no point doing IgG when the baby is still breastfeeding and the mother is not eating gluten.

For that matter, if an adult is not eating gluten then there is no point looking for specific antibodies be they IgA or IgG.

gfp Enthusiast

The plot thickens,

I contacted the lab Nikki linked to and asked if with it being a sample of buccal mucosa if the presence of breast milk would confuse the results.

I was expecting some answer about waiting but instead I got the answer that they can't guarantee the process in these circumstances.

My thinking (which may or may not be correct) is the genetic material in breast milk from the mother includes the IgA antigens which all reside in the HLA portion of chromosome 6.

Well, I was expecting a different response (something negative or positive) rather than ...

Dear Stephen,

I

Jestgar Rising Star

Testing for genetic markers is done by pcr, polymerase chain reaction, which takes very small amounts of DNA and copies it over and over.

Normally they are testing between two versions of one part of a gene, so the test sections might look like this:

atgatggcctgatgatcgtaga

atgatggccagatgatcgtaga

with only the one letter being different.

If you think of an X Y plot for the next part that will help you visualize.

If both of your genes have the 't' then your test will show a dot in the lower right (maybe 4,1 on a plot)

if both of your genes have the 'a' then your test will show a dot in the upper left (maybe 1, 4 on a plot)

(or the other way around, depending on what dyes they used)

if you have one of each, your test will have a dot in the middle of the graph (maybe 2,2).

This is a representation of the kind of results you get.

image003.webp

Each dot is one person, and they usually run 384, or 1536 tests at one time. This is actually a very clean result, where none of the clouds overlap, but to get a picture like this is extraordinarily rare. Normally the clouds are much more spread out, and many of your dots can't be determined

This test is incredibly sensitive, and if even one cell from the mom is in the sample, the results may not be accurate. The dot will shift slightly in one direction or another, and you won't be able to tell which cloud it falls in.

I would suspect that mom sheds quite a few cells into breast milk, and from the skin on her breast, so the potential for a contaminated sample is very very high.

gfp Enthusiast
This test is incredibly sensitive, and if even one cell from the mom is in the sample, the results may not be accurate. The dot will shift slightly in one direction or another, and you won't be able to tell which cloud it falls in.

I would suspect that mom sheds quite a few cells into breast milk, and from the skin on her breast, so the potential for a contaminated sample is very very high.

Thanks ... that sums it up perfectly!

Other than babies one wonders who else the genetic test is useful for. (A few obvious ones here like I'm actually growing the fetus in a test tube to harvest the kidneys and just want HLA results to check organ compatibility)

Honestly: I really doubt it's the first baby they did the test for... and the email is CYA because of the chance of screwing up the test. This is of course lucky for me asking the question ... unlucky for all those who figured their MD, Ped or the labs would point out the damned obvious!

Are not Leukocytes a component of breast milk anyway? Will these not be replicated in the PCR unless it is specific single cell PCR not to mention shedding cells from the nipple?

Jestgar Rising Star

Mom's cells all have the same DNA. Different cells translate different parts of it into RNA, and then protein. Since the PCR test is on DNA, it doesn't matter what the source cell is.

BirdWatcher Newbie
Genetic testing will let you know if he's a carrier only, or if he has 2 copies of the gene..

Can someone explain this to me? How can you be a carrier? I thought you were either genetically predisposed or not.

gfp Enthusiast
Mom's cells all have the same DNA. Different cells translate different parts of it into RNA, and then protein. Since the PCR test is on DNA, it doesn't matter what the source cell is.

So for the rest of us (and just to confirm) that pretty much questions the use of saliva and buccal mucosa (cheek cells) for babies being breast fed? (or for the sake of completeness cannibals) :ph34r:

gfp Enthusiast
Can someone explain this to me? How can you be a carrier? I thought you were either genetically predisposed or not.

Open Original Shared Link

Jestgar Rising Star

Yes, neither breast fed babies, nor cannibals should have a DNA test on buccal cells

  • 1 month later...
Toni T. Newbie

Hello all, I've been diagnosed for 2 years but am just now joining the forum.

I have two children, a 3 year old and a 10 month old. My 3 year old had a negative blood panel, as did I (although my scope and pathology gave a definite diagnosis). I've kept the baby gluten free.

I want to get the genetic test done to see if there is any chance either child could develop Celiac Disease. Has anyone had this done for this reason? My reasoning is that if either child carries one or both genes, I would just consider them positive and go gluten free to be safe. And if they do not carry any genes, I would consider them safe/negative. Neither child has had any symptoms whatsoever.

I'm also due to deliver baby number 3 in April. I want to get the genetic testing done asap, so a saliva sample is out for all three - my toddler ain't gonna go for spitting in a test tube! My insurance (of course) will not cover the testing. Is there any place more reasonable yet still as accurate as Kimball? It's $375 a pop, which will put a hurt on my budget...although it's worth it to rule out/in the possiblity of Celiac's.

Any advice?

  • 3 months later...
MissAmie Newbie

Hello all, I've been diagnosed for 2 years but am just now joining the forum.

I have two children, a 3 year old and a 10 month old. My 3 year old had a negative blood panel, as did I (although my scope and pathology gave a definite diagnosis). I've kept the baby gluten free.

I want to get the genetic test done to see if there is any chance either child could develop Celiac Disease. Has anyone had this done for this reason? My reasoning is that if either child carries one or both genes, I would just consider them positive and go gluten free to be safe. And if they do not carry any genes, I would consider them safe/negative. Neither child has had any symptoms whatsoever.

I'm also due to deliver baby number 3 in April. I want to get the genetic testing done asap, so a saliva sample is out for all three - my toddler ain't gonna go for spitting in a test tube! My insurance (of course) will not cover the testing. Is there any place more reasonable yet still as accurate as Kimball? It's $375 a pop, which will put a hurt on my budget...although it's worth it to rule out/in the possiblity of Celiac's.

Any advice?

I carry 2 copies of DQ2, my older 3 have at least one copy of DQ2. My maternal grandma was diagnosed celiac over 20 years ago via biopsy. Her second cousin also has celiac. The kids and I gave had little but different symptoms suggesting celiac but our iga levels were low when tested a few years ago. We are getting retested next month ang I'll be insisting that our kids are retested for the gene as I belive when they were tested Prometheus only showed if you had one copy of a gene, not a double copy when I was tested 5 months later. I feel its important to know if you carry the gene. With my family history I had to insist to be tested and argued with my old doctor because she said the test was 'expensive.' I replied 'so what.' I think peace of mind is good either way...to rule it out, or knowing you need to monitor yourself and your family.

Archived

This topic is now archived and is closed to further replies.

  • Get Celiac.com Updates:
    Support Celiac.com:
    Donate

  • Celiac.com Sponsor (A17):
    Celiac.com Sponsor (A17):





    Celiac.com Sponsors (A17-M):




  • Recent Activity

    1. - cristiana replied to HelloFlowersGoodbyeFlour's topic in Related Issues & Disorders
      6

      Anyone else get a lot of upper respiratory infections?

    2. - HelloFlowersGoodbyeFlour replied to HelloFlowersGoodbyeFlour's topic in Related Issues & Disorders
      6

      Anyone else get a lot of upper respiratory infections?

    3. - HelloFlowersGoodbyeFlour replied to HelloFlowersGoodbyeFlour's topic in Related Issues & Disorders
      6

      Anyone else get a lot of upper respiratory infections?

    4. - cristiana replied to HelloFlowersGoodbyeFlour's topic in Related Issues & Disorders
      6

      Anyone else get a lot of upper respiratory infections?

    5. - trents replied to HelloFlowersGoodbyeFlour's topic in Related Issues & Disorders
      6

      Anyone else get a lot of upper respiratory infections?

  • Celiac.com Sponsor (A19):
  • Member Statistics

    • Total Members
      134,125
    • Most Online (within 30 mins)
      10,442

    psasso76
    Newest Member
    psasso76
    Joined
  • Celiac.com Sponsor (A20):
  • Celiac.com Sponsor (A22):
  • Forum Statistics

    • Total Topics
      121.7k
    • Total Posts
      1m
  • Celiac.com Sponsor (A21):
  • Who's Online (See full list)

  • Upcoming Events

  • Posts

    • cristiana
      Definitely worth speaking to your gastroenterologist about this. My own told me that by using Gaviscon a barrier forms over the contents of the stomach and stops gas and acid irritating the throat.  In fact, he said to me that because I found relief using Gaviscon that was a very clear indicator that reflux was the cause of that particular issue.   A wedge pillow will really help with this - or raising the top bed legs with bricks.
    • HelloFlowersGoodbyeFlour
      I did get the pneumonia vaccine about 4 years ago. I had this amazing allergist who did all those vitamin deficiencies test and told to get that vaccine. Unfortunately she retired.  I haven’t been to an allergist in a few years,  I’m not sure what my levels are now. I did have a pulmonologist who wasn’t concern and said I seemed fine to him that I was young etc. But yes I think I should at the very least get a different opinion. Thank you for your reply 
    • HelloFlowersGoodbyeFlour
      Yes I do have acid reflux. I’m not on anything for it at the moment. I sometimes wonder if that’s what it could be because I get heart burn every night. I may revisit my gastrointestinal doctor again. Thanks for the reply  
    • cristiana
      Hi @HelloFlowersGoodbyeFlour I wonder if you suffer from reflux, as if you do, you may find it could also be irritating your airways.  I shall explain: I have to use a blue inhaler from time to time, and it seems to be related to reflux.  Never had any trouble before my coeliac diagnosis, the reflux seemed to be something that developed following a holiday to France in 2019, where I had been exposed to gluten.    The reflux continued into the autumn and winter, my throat itched to begin with, particularly after meals, but it then that feeling of irritation seemed to spread to my lungs.  I even found it difficult to breathe on occasion. What stopped it in its tracks was using a wedge pillow at night, following a reflux diet (you can find them online), not eating 2-4 hours before bed and also having a dose of Gaviscon Advanced at night, which forms a barrier so that acid/food can't go back up your esophagus.  The throat irritation faded, and then I found it easier to breathe again. Just mentioning in case it could be a contributing factor.
    • trents
      Since initially getting your D checked a few years ago, has it since rebounded to normal levels? Sounds like at some point you got it checked again.
×
×
  • Create New...