Jump to content

Jestgar

Advanced Members
 View Profile  See their activity

  • Posts

    9,196

  • Joined

  • Last visited

  • Days Won

    42

 Content Type 

Profiles

Forums

Events

Blogs

Latest Celiac Disease News & Research:

Everything posted by Jestgar

  1. Jestgar
    What he said.
  2. Jestgar
    This one has some math, and interesting comments at the bottom Open Original Shared Link
  3. Jestgar
    I like this one Open Original Shared Link
  4. Jestgar
    A couple articles on insurance companies' ability to cancel your insurance. Open Original Shared Link Open Original Shared Link Open Original Shared Link Open Original Shared Link Open Original Shared Link I couldn't find any that specifically address private vs paid for by your company
  5. Jestgar
    I'm also curious if you have any numbers about what percentage of publicly funded health care is spent on illegal immigrants.
  6. Jestgar
    Just in case you missed that. My niece has publicly funded insurance for her and her son. She's a full time student. Unemployed, yes, but with a goal. Doesn't she deserve good health care? If you read the plan (I posted a link to the text for you), you'll see that they are proposing a public plan option that you could choose, or choose to remain...
  7. Jestgar
    Oh! I forgot I work in Seattle, so I'm here every (week) day. Let's have lunch. ummmm did a little soap box stand on the health care thread.. :ph34r:
  8. Jestgar
    I just went to a talk about the health care reform situation. I heard some interesting numbers which, unfortunately I can't back up with sites, but I suspect you could research them yourself. The talk was given by two physicians. 30% of Americans are (already) covered by a government health care plan (medicare/medicaid) 50% have health care paid for...
  9. Jestgar
    Some stories from doctors Open Original Shared Link The text of the bill under consideration Open Original Shared Link physicians' opinion Open Original Shared Link another physician site Open Original Shared Link
  10. Jestgar
    Members of the royal family, it is noted, enjoy eating the food and drink of the country or region they're visiting. So break out the BeaverTails, poutine, maple syrup and Bloody Caesars
  11. Jestgar
    Cold and rainy here -- very much like November...
  12. Jestgar
    Rye - asthma uncooked wheat - asthma, headache cooked gluten - headache, brain fog, some tummy pain soy - tummy pain, gastro corn - joint pain 3 days later peaches - throat swells shut mold - massive headache if too much, nothing if just a little sulfites - major gastro if to much, minimal if just a little something? - heart races something else...
  13. Jestgar
    Yes, neither breast fed babies, nor cannibals should have a DNA test on buccal cells
  14. Jestgar
    Excellent news!!!
  15. Jestgar
    Mom's cells all have the same DNA. Different cells translate different parts of it into RNA, and then protein. Since the PCR test is on DNA, it doesn't matter what the source cell is.
  16. Jestgar
    I tend to believe that you are the best resource for understanding your body. I also don't believe in testing for something when you don't have a problem. If gluten-free over several weeks doesn't clear up all symptoms, then other tests should be considered. Or do food testing as others have suggested. That just wouldn't work for me.
  17. Jestgar
    Testing for genetic markers is done by pcr, polymerase chain reaction, which takes very small amounts of DNA and copies it over and over. Normally they are testing between two versions of one part of a gene, so the test sections might look like this: atgatggcctgatgatcgtaga atgatggccagatgatcgtaga with only the one letter being different. ...
  18. Jestgar
    Have you had your blood pressure checked? Are you dehydrated?
  19. Jestgar
    If you are better after changing your diet, what is there to test for? If you somehow had chosen not to eat wheat for other reasons (Atkin's, for example) and knew nothing about Celiac or gluten intolerance, would he still be wanting you to get tested for *something* ? If you have no symptoms, you have nothing to test for.
  20. Jestgar
    The blood tests won't be positive until you have done sufficient damage to your intestines. You can have symptoms before you are sick enough to have a positive blood test.
  21. Jestgar
    If you use the search function you'll discover that this topic has come up before, and yes, people do test negative.
  22. Jestgar
    snrt she needs to practice more. tired and going to bed (yes, it's 7:30). meals made 4 kitchens insulated 1 cat pee glooped with enzyme cleaner lots rehearsal 1 pre-rehearsal martinis 1 (must start earlier next time) I did manage to take the rest of the hollowe'en candy to the food bank (because surely they need more crap to...
  23. Jestgar
    I have bags of different frozen greens (spinach, mustard, whatever they have) and mix them into eggs or stir fry. I just made a couple crockpot meals with fresh mustard greens (I don't use frozen veggies in the crock, for no particular reason). I've also chopped lettuce that's on it's last legs and mixed into soup, stir fry, whatever, immediately after...
  24. Jestgar
    POUTY FACE!! We must figure a way around your isolation! Library? Mug a businessman for his blackberry?
  25. Jestgar
    I gotta finish insulating the kitchen today, having committed to the dry wall guy coming next week. I'm just not a fan of anything involving actual labor. Would much rather supervise.....by phone.......from a distant, more pleasant place......with a drink in my hand.....
×
×
  • Create New...

Important Information

NOTICE: This site places This site places cookies on your device (Cookie settings). on your device. Continued use is acceptance of our Terms of Use, and Privacy Policy.